Institute of Cancer Research - PDFSEARCH.IO - Document Search Engine

Institute of Cancer Research
Results: 2628

#	Item
101	How does histology alter treatment? Add to Reading List Source URL: www.euikcs.com Language: English - Date: 2014-05-13 15:18:43 Institute of Cancer Research Medicine Kidney cancer Schonfeld
102	Introduction to the National Cancer Institute’s Interest in e-ASIA Julie A. Schneider, Ph.D. Program Director Add to Reading List Source URL: www.the-easia.org Language: English - Date: 2014-10-21 02:06:34 National Institutes of Health Cancer research Bethesda Maryland Nursing research National Cancer Institute Cancer Epidemiology of cancer National Institute of Environmental Health Sciences National Institute of Neurological Disorders and Stroke Medicine Health Cancer organizations
103	COMMENT CONSERVATION Comparing two calls to embrace humans’ impact on nature p.29 Add to Reading List Source URL: adv-cellbio2011.sciencesconf.org Language: English - Date: 2012-06-28 08:00:52 National Institutes of Health Nursing research Academia Creativity Massachusetts Institute of Technology Health MIT Media Lab Medicine Bethesda Maryland Cancer research
104	July 11, 2012 The Honorable Harry Reid U.S. Senate Majority Leader 522 Hart Senate Office Building Washington, DC 20510 Add to Reading List Source URL: www.federalrelations.wisc.edu Language: English - Date: 2014-11-04 10:17:34 Cancer research Nursing research Health Alternative medicine Medical centers in the United States National Institute of Mental Health John E. Fogarty International Center National Institutes of Health Medicine Bethesda Maryland
105	科学技術振興機構報　第　　　号 Add to Reading List Source URL: www.the-easia.org Language: English - Date: 2015-05-19 20:46:16 Bethesda Maryland Cancer research Nursing research National Institute of Allergy and Infectious Diseases Thailand National Science and Technology Development Agency Medicine National Institutes of Health Health
106	LOGO USAGE POLICY (Updated November 5, 2013) I. Use of NCI Cancer Center Logos Add to Reading List Source URL: cancercenters.cancer.gov Language: English - Date: 2013-11-05 10:31:32 National Institutes of Health National Cancer Institute NCI-designated Cancer Center The Cancer Genome Atlas Medicine Cancer organizations Cancer research
107	Microsoft Word - 20150401_Basilea_In-licensing panRAF_EN.docx Add to Reading List Source URL: www.basilea.com Language: English Basilea Pharmaceutica Institute of Cancer Research Cancer research Cancer Research UK Medicine Cancer organizations Health
108	Cancer Center Support Grant Add to Reading List Source URL: prevention.nih.gov Language: English - Date: 2015-04-23 15:34:54 Health University of Pittsburgh Cancer Institute Research NCI-designated Cancer Center Clinical trial Medicine Cancer organizations University of Pittsburgh
109	FOREWORD Fifty years ago, led by President Charles de Gaulle, France set an ambitious goal by proposing the establishment of an international cancer institute under the auspices of the World Health Organization (WHO). Add to Reading List Source URL: www.iarc.fr Language: English - Date: 2015-05-15 06:48:49 World Health Organization Carcinogen Paolo Boffetta Medicine Cancer organizations International Agency for Research on Cancer
110	CTGACTGATAGTCACTGGAGTCATAGCTGACTGACATGCAAATCAACTGACTGACTGAAAGTCACTGTGGTCAAAACTGACTGACTATG GTCACTGGTGTCAAAACTGACTGACTGAAAGTCACGATAACTGAGGGGGGTCAAAACTGACTGACTGAAAGTCACTGGGGTCTAAGGC CTGACTGAAAGTCACTGAGGTCAATACTGACTGACTATGTA Add to Reading List Source URL: www.aaci-cancer.org Language: English - Date: 2015-01-20 15:57:20 Yale Cancer Center NCI-designated Cancer Center University of Chicago Comprehensive Cancer Center Cancer research University of Texas MD Anderson Cancer Center Duke Cancer Institute Cancer organizations Medicine Association of American Cancer Institutes

UPDATE